Andy100100 Andy100100
  • 01-09-2020
  • English
contestada

A 6 pound bag of potatoes cost $12.90. How much would a 3.4 pound bag cost?

Respuesta :

melgal12
melgal12 melgal12
  • 01-09-2020

Answer:

$7.31

Explanation:

6 pounds = $12.90

1 pound = $2.15

3.4 pounds x $2.15 = $7.31

Answer Link

Otras preguntas

Thomas Jefferson and the democratic republicans
need help pls pls thank u thank u
If there are important external benefits associated with the consumption of a product:_______. A. special excise taxes should be levied on producers of the pro
HELP PLEASE PLEASE I WILL GIVE BRAINLIEST
transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
In a garden, 1/3 of the flower are yellow,1/6 of them are pink, and 1/3 of the remaining flowers are red.If there are 120 flowers, how many are red? How many ar
1. Which sentence is written correctly? a. The butterflies were covering the windshield. I wanted to admire their beauty; but the way they covered the car was m
What is 21 dimes to go 30 dimes​
A man with Type A blood marries a worban with Type AB blood. According to predicted outcomes based on genetics, their children may have all blood types EXCEPT
Which of these can help you avoid information overload? A. Breaking down information into smaller pieces B. Keeping a running list of new words C. Reading only