video4all video4all
  • 04-03-2021
  • Biology
contestada

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

Respuesta :

addysenseheult addysenseheult
  • 04-03-2021

Answer:

AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG

Explanation:

this is the complementary strand for the mRNA.

A=U

C=G

G=C

T=A

this is the key for any mRNA strand.

;)

Answer Link

Otras preguntas

Stress generally occurs when someone? A.becomes overconfident B.disregards others C.feels overwhelmed
Tom can paint the fence in 12 hours, but if he works together with a friend they can finish the job in 8 hours. How long would it take for his friend to paint
the word enamored means
What fraction is equivalent to 0.46464646··· A. 46⁄99 B. 46⁄999 C. 46⁄100 D. 23⁄50
Which of the following compounds does NOT contain molecules? Question 2 options: CO2 H2 NaCl H2O
Can someone answer this question for me please
tan65°-tan25°=2tan40° prove !!!
Need help on 88 please !!
What ethic groups are most affected by obesity and why?
who long does it take to drive 150 miles at 45 miles per hour