miaclaytonM9876 miaclaytonM9876
  • 04-04-2018
  • History
contestada

How did the emancipation proclamation change the nature of the civil war? it prompted the confederacy to surrender?

Respuesta :

partysuperb15 partysuperb15
  • 04-04-2018
The emancipation proclamation changed the nature of the civil war by showing that the south had slaves. Since the south had slaves, Great Britan and France were reluctant to help the Confederacy. Although the emancipation proclamation changed the nature of the civil war, it didn't prompt the Confederacy to surrender since they fought on for 3 more years.
Answer Link

Otras preguntas

The 1954 supreme court case that ruled racially segregated school systems "inherently unequal" was
What was the main idea of Rousseau's famous work "The Social Contract".
In a standard normal curve, what percentile corresponds to a z-score of 2.0?
stuck i need help please
Can things of aluminum have a greater mass than things made of iron?
Find 8 + 35 + (-76).
2. You must use headlights when driving ___________________. A. between sunset and sunrise B. in rain C. half hour after sunset and half hour before sunrise D.
Many worship services include a speech given by a church leader. this speech is called a
What two molecules are produced by the light reactions and used to power the calvin cycle?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat