quanphong304 quanphong304

01-08-2022
Mathematics

contestada

-(2021.0,7+19,75)+2021.0,7-(8-19,75)

Respuesta :

sangers1959 sangers1959

01-08-2022

Answer: -8.

Step-by-step explanation:

-(2021.0,7+19,75)+2021.0,7-(8-19,75)=-2021.0,7-19,75+2021.0,7-8+19,75=-8.

Answer Link

Otras preguntas

Solve the system algebraically. check your work. 2x + 5y = 10 2x + 3y = 6

How are logos, pathos, and ethos I used in an argument

What is the difference in elevation between a plane flying at 25,500 ft above sea level and a submarine traveling 450 ft below sea level?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Which of the following are considered irregular verbs? Poner and lavar Poner and hacer Bañar and poner Lavar and hacer

Which sentence best describes how a business letter should be written? A business letter should have its body aligned to the right margin of the page. A busines

How and where (at what latitudes) do atmospheric convection cells form?

A fitness contract is a/an A. evaluation of strength, flexibility, endurance, and proper nutrition. B. written document stating an individual's

Suppose Naomi gets a sales bonus at her place of work that gives her an extra $600 disposable income. She chooses to spend $360 and save the remaining $240. Fr

Solve the given inequality and graph the solution on a number line. I need it on a graph -x/2 +3/2 <5/2