madisonfrazee08 madisonfrazee08
  • 02-03-2022
  • Mathematics
contestada

Which inequality is graphed on the grid?
A. 6x + 2y = 3
B. 2x + 6y > 9
C. 6x + 2y > 3
D. 2x + 6y < 9

Which inequality is graphed on the grid A 6x 2y 3 B 2x 6y gt 9 C 6x 2y gt 3 D 2x 6y lt 9 class=

Respuesta :

alysonjolivares alysonjolivares
  • 07-03-2022

Answer: 2x+6y<9

Step-by-step explanation: it’s the correct answer

Answer Link

Otras preguntas

With the sentence, (ran a mile) is it a noun phrase or a verb phrase
Choose the answer that best completes the sentence below. Astronaut wives had the difficult job of caring for homes and children with little or no help, _____ t
Which audience does the passage most likely target? A. members of the House Judiciary Committee B. the President of the United States C. people from Jordan’s
Need help asap whoever helps big thank you!
what are the diffrents between hand washing and surgical hand washing?
Joe has $6.40 in nickels and quarters. He has two more nickels than quarters. How many quarters does Joe have?
I need 5 sentences on the History of Costa Rica!!!!!!!!!!!!!!!!!!!!!!!!!
which statement best describes the set 14 16 18 20 22​
Where and when was Geoffrey Chaucer born?
Given the sequence ATGGCGAATCACGTCACTTGA a) Write the sequence of nucleotides for the complementary strand of DNA. b) Write the mRNA sequence transcribed from t