lisapressley2001
lisapressley2001 lisapressley2001
  • 03-01-2017
  • Mathematics
contestada

3. Simplify: 2^2√2x+6^4√2x

Respuesta :

Аноним Аноним
  • 03-01-2017
I hope this helps you




square root of 2x (2^2+6^4)



square root of 2x (2^2+2^4.3^4)



square root of 2x (2^2 (1+2^2.3^4))



square root of 2x (4.325)



square root of 2x. 1300


1300.square root of 2x
Answer Link

Otras preguntas

An archer’s arrow follows a parabolic path. The height of the arrow f(x) is given by f(x) = -16x^2 + 200x + 4, in feet. Find the maximum height of the arrow.
Sophia bought 3 yards of trim to put around a rectangular scarf. She wants the width of the scarf to be a whole number that is at least 6 inches and at most 12
Explain why applying a vertical translation and then a horizontal translation produces the same result as applying a horizonatal translation and then a vertical
what is 15/24 in simplest form
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Aiden wrote a riddle: Five less than 1/5 times a number is same as the sum of the number and 1/3. Find the number
What statement best describes a republic?
Which powerful religious group often tried to close the theaters in Shakespeare's time? A. the Puritans B. the King's Men C. the Pilgrims D. the Jacobites
how can you write 0.45 as fraction and a percentage ,please show work
Dalia has just enough money to buy either 6 pears and 20 oranges or 12 oranges and 11 pears. A pear costs $ 0.80. How much does an Orange cost ?