jstzWi6dysrames jstzWi6dysrames

02-01-2017
Biology

contestada

The discovery of ________ explains embryonic pattern formation in a wide variety of organisms.

Respuesta :

Аноним Аноним

02-01-2017

Answer would be homeotic genes.

Answer Link

Otras preguntas

31. The skin, lungs, and digestive system __________. A. transport broken-down chemicals out of the body B. are not affected by drugs C. always speed up when dr

NEED HELP WORTH 50 POINTS !! Holly has a rectangular garden that measures 12 m wide by 14 m long. She wants to increase the area to 255 m2 by increasing the wi

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

For the right triangle with side of lengths 5 12 and 13, find the length of the radius of the inscribed circle

Multivitamin/mineral supplements should never be given to toddlers. a. True b. False

Which are barriers to seeking mental health treatment? Check all that apply. feeling embarrassed having health insurance dealing with peer pressure having limit

An element's atomic number is 64. How many protons would an atom of this element have?

Determine the number of real solutions each quadratic equation has. y = 12x2 - 9x + 4 __ real solution(s) 10x + y = -x2 + 2 __ real solution(s) 4y - 7 = 5x2 -

What was the main idea of Rousseau's famous work "The Social Contract".

Hafsah is feeling upset lately. Which questions should Hafsah ask herself to determine whether she needs to seek professional mental health services? Check all