angelojaviercarita angelojaviercarita

03-09-2021
Health

contestada

que es la de forestacion

Respuesta :

aaliyahduffy36 aaliyahduffy36

03-09-2021

Answer:

: the act or process of establishing a forest especially on land not previously forested.

Explanation:

Answer Link

Otras preguntas

How many amino acids would be included in the polypeptide encoded by the following mRNA S'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUUUUCAAGAA3 a. 7 b. 8 c. 9 d. 10

Which of the following statements about electron degeneracy pressure and neutron degeneracy pressure is true? a.Both electron degeneracy pressure and neutron de

True or False. To do some yoga is a fantastic way to build body muscle while also relaxing.

A teacher is having three students take care of 28 goldfish during the summer. He gave some of them to Alaina. Then he gave twice as many to Miguel. He gave twi

In triangle ABC, angle A is equal to angle C, BA=x+20,CA=4x-30, and BC=3x+14. What is the length of BC?

What was the impact of the civil war in the population of Louisiana?

please help asap!! thank you

You found a groupon for 25% off 4 tickets for Christmas town, at Busch gardens a ticket cost 54.65 each you and your three friends decided to go calculate the e

Please hurry! If you don't know it, that's okay. What is the solution to the system of equations below? y = 2/5 x - 3 and x = –10 (–10, –7) (–10, –1) (–7, –10)

Which of the following statements correctly describes the items shown below? y = 8x-13 A. Item I is decreasing. Item II is increasing. B. Both items are decreas