joseph04adams joseph04adams
  • 03-06-2021
  • Mathematics
contestada

Find the area AND perimeter of this shape.

Find the area AND perimeter of this shape class=

Respuesta :

Kawaiikitty21
Kawaiikitty21 Kawaiikitty21
  • 03-06-2021

Answer:

Area: 2206.86 square m

Perimeter: 194.25 m

Step-by-step explanation:

Area:

30 x 50 = 1500 square m

30/2 = 15 = the radius of the semi circles

pi x 15^2 = 706.86 square m

1500 + 706.86 = 2206.86 square m

Perimeter:

pi x 15 x 2 = 94.25 m

94.25 (perimeter of both semi circles) + (50 x 2) = 194.25 m

Answer Link

Otras preguntas

the volume of a sphere is 2254 pi ^3 what is the surface area of the sphere
what are good websites to study for biology?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
The perimeter of an equilaterak triangle is 858 millimeters. find the length of each side
plz help 10 pts A temporary magneta easily loses its magnetism.b has two north poles.c keeps its magnetism for a long time.d cannot be destroyed.
What US policy was designed to handle the threat of communism spreading to the Middle East in the 1950s? A. The Kennan plan B. The Middle East doctrine C. Th
Proof: it is given that angle 1 and angle 2 are supplementary. angle 1 and angle 3 are also supplementary, so angle 2 is equal or equivalent to angle 3. since _
crystal lattice definition
Please help I'm trying to figure out 4-15 but i don't know how to.
Illinois senator who believed slavery question should be settled by popular sovereignty