ellabellastella123 ellabellastella123

02-03-2021
Mathematics

contestada

Point B is at (4, 5). It is reflected on the x-axis. What are the coordinates of its image, B'?

Respuesta :

austinthig101 austinthig101

02-03-2021

Answer: (4, -5)

(so it sendswfegrgnhernth4retn)

Answer Link

Otras preguntas

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

Balance the following unbalanced redox reaction (assume acidic solution if necessary): Cr2O72- + Cl- → Cl2 + Cr3+ Indicate the coefficient that will be used for

Your friend is auditioning for a position in a rock band. She, however, has not practiced much and still considers the tune very difficult to play. According to

The Rialto Theatre purchased a new projector costing $82,000 on January 1, 2018. Because of changing technologies, the projector is estimated to last four years

Simplify the following: 2/3+2^3 -1/3

A solution was prepared by dissolving 125.0 g of KCl in 275 g of water. Calculate the mole fraction of KCl. (The formula weight of KCl is 74.6 g/mol. The formul

What is the term used when the entire nation is called into service during ? Absolute War Total War Proxy War Civil War

Is 2(x-y) and 2x-2y equivalent

Damon is using his weekly allowance to spend on video games and movies. This week, on top of his allowance, he gets a bonus from his mother for taking out the t

what is a word problem for y=3.5x+4