Seudónimo Seudónimo

02-09-2020
Mathematics

contestada

Can y’all help me my time is almost over I need this ASAP and I’ll give brainliest

Can yall help me my time is almost over I need this ASAP and Ill give brainliest class=

Respuesta :

hannifordshenea9 hannifordshenea9

02-09-2020

Answer:

Based on the question. D, would make the most sense.

Answer Link

Otras preguntas

"which band was led by guitarist peter buck and vocalist michael stipe?"

Decide if the following command is grammatically correct or incorrect. (tu) no digo mentiras.

Quinn is determining the area of a trapezoid. His work is shown below. mc012-1.jpg Step 1: Break the figure into rectangles and triangles. mc012-2.jpg Step

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Can you plz help me I don’t know what alliteration I tried searching it up on google but I don’t understand

Describe the set of data {33, 35, 38, 44, 45, 45, 46, 46, 46, 47}. a. normal distribution c. cannot be determined b. negatively skewed d. positively skewed

Find the equation of a line passing through the point (−3, 5) and making an angle of 16° with the x-axis

How did immigration affect immigrants and other americans in the 1900s?

Who basically "began" England's religious reformation?

The substance in the digestive system that lubricates moistens and protects the surface of the lumen is