lmora7715 lmora7715
  • 03-07-2020
  • Mathematics
contestada

What is the midpoint of the segment shown below?

What is the midpoint of the segment shown below class=

Respuesta :

wegnerkolmp2741o
wegnerkolmp2741o wegnerkolmp2741o
  • 03-07-2020

Answer:

The midpoint is (0,2)

Step-by-step explanation:

To find the x coordinate, average the x coordinates of the endpoints

(-4+4)/2 = 0/2 =0

To find the y coordinate, average the y coordinates of the endpoints

(6+-2)/2 = 4/2 =2

The midpoint is (0,2)

Answer Link

Otras preguntas

The hydrosphere includes _____ 2.20 unit assessment: fundamentals of ecology, part 1
The Hellenistic age was characterized by all of the following EXCEPT
Which section of an article would you look at to find out if assessors were blinded to treatment assignment?
what is the final product? ^5sqrt4x^2 ^5sqrt4x^2
Two sides of a triangle have the following measure of 7,8.what is the range of possiable values for the 3rd side?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
31. The skin, lungs, and digestive system __________. A. transport broken-down chemicals out of the body B. are not affected by drugs C. always speed up when dr
A line with an underfined slope contains the point (8,3). The point (?, -4) is also on the line. What is the missing x-coordinate?
Given the sequence in the table below, determine the sigma notation of the sum for term 4 through term 15. n an 1 4 2 −12 3 36
Why were senators able to amass more power and influence than congressmen during the gilded age?