catalina1119 catalina1119
  • 02-07-2020
  • Mathematics
contestada

The distance from the Earth to Saturn averages 886 million (886,000,000) miles. Write this number in scientific notation.

Respuesta :

sqdancefan
sqdancefan sqdancefan
  • 04-08-2022

Answer:

  8.86×10⁸

Step-by-step explanation:

The most significant digit of the number is in the hundred millions place. The exponent of 10 associated with that number place is 8, so the multiplier in scientific notation is 10^8.

Scientific notation

The significant digits of the number are written with one of them to the left of the decimal point. The power of ten multiplier is that associated with the place value of the most-significant digit.

  886 million = 8.86×10⁸

Ver imagen sqdancefan
Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
What is the diameter of a circle whose circumference measures 86 26/35? Use pi= 22/7
20 points People disagree whether the United States should have gone to war against Mexico. Should the United States have declared war? Opinions Please The Unit
A youth ice hockey game has 3 periods that are each 20 minutes long. Colin plays 12 minutes each period. Which ratio shows Colin's playing time compared to the
How many years does an apple tree live useful?
Which word has the long i sound? relieve speciality society social
the bombing of Hiroshima and Nagasaki resulted in
What was religion like in Shang China?
In a probability experiment, Craig rolled a six-sided die 55 times. The die landed on a number greater than three 31 times. What is the ratio of rolls greater t
how do you know 8 thousandths is less than 1 hundredths