sophiafriend34 sophiafriend34
  • 15-05-2020
  • Biology
contestada


Is the below sequence DNA or RNA? How do you know?
GTTTACAGGCGGCGCAATATCTGATCG

Respuesta :

queenb74
queenb74 queenb74
  • 15-05-2020
The answer is DNA I know because I know
Answer Link
savitar0291 savitar0291
  • 15-05-2020

Answer: DNA

Explanation: DNA has Thymine, Guanine, Cytosine, and Adenine.

RNA has all of those except for adenine which is replaced with Uracil.

Answer Link

Otras preguntas

Helppppppppppppppppppp
Carlos es un chico muy _____. A. ordenada B. gusto C. estudiosos D. simpático
Why is learning about other countries important?
What is the 7th term of the geometric sequence where a1 = 1,024 and a4 = −16? I got -0.25 for the answer but I'm not sure if it's right, can someone check for m
How are folktales and fairy tales related?
The distance between points
Which function is shown in the graph below?
Write an equation of the line that has a slope of 5 and y-intercepts 3 in slope-intercept form.
Children with visual impairments tend to be more _______ in social environments.        A. aggressive   B. adventurous   C. passive   D. demanding
What are the components of earths life support system