kiitykat93 kiitykat93

04-05-2020
Mathematics

contestada

On Friday the store ordered 751 pens on Saturday the store ordered another 119 how many pens did the store order in all

Respuesta :

listenhoneymc listenhoneymc

04-05-2020

Answer:

870

Step-by-step explanation:

751 + 119 = 870

Answer Link

mchris3080 mchris3080

04-05-2020

Answer:

870

Step-by-step explanation:

751+119=870

Answer Link

Otras preguntas

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

X Which of the following was a consequence of the Stono Rebellion? A. Slavery was abolished in New York. B. Harsher slave codes were enacted in South Carolina.

Describe Lt. Frederick Schwatka's journey. Who did he travel with? How did he travel?

Which body can begin an impeachment process? the Senate the Supreme Court the State Department the House of Representatives

BRAINLIEST WILL BE GIVEN TO TOP TWO ANSWERS!! PLS HELP!! Solve Ax − By = C for x. x equals the quantity negative B times y plus C all over A x equals the quan

help me with this ans should be well explained

The combination of alcohol with other drugs can produce a _________ effect and alter or increase the effect of alcohol alone.

Help me please.............

what do you call the lines of lead that hold a stained glass window together? A. Radial B. Gothics C. Tracers D. Tracery please help!!!

Please help me on this question please ASAP