ellethrash ellethrash

04-09-2019
Mathematics

contestada

0.6667 converted into a fraction in simplest form

Respuesta :

kgvargas978oz0nv5 kgvargas978oz0nv5

04-09-2019

6667/1000 i think im right

Answer Link

Otras preguntas

William Blake believed that it was necessary to A. use experience as the pathway to God. B. eradicate evil from the human condition. C. fear darkness or lose

NEED HELP ASAPPPPPPP

Compare and contrast the rise of franklin d. roosevelt in 1932 with the rise of adolf hitler in 1933.

The term used when an organism is studied in its natural environment is

What central idea does wollstonecraft explicitly state in this passage? a lack of education will not make women care only about household issues. women are natu

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

HR contains six red chili beans for green jellybeans and four blue jelly beans if we choose a jellybean then another jellybean without putting the first time ba

Solve the system algebraically. check your work. 2x + 5y = 10 2x + 3y = 6

To what does the poet compare the lass? A. nomads B. musicians C. birds D. sailors

(8n+1)(6n-3) please solve in quadratic formula