ellirenn18 ellirenn18

03-03-2017
Chemistry

contestada

give reasons on why soil is important? please help!! :)

Respuesta :

Itsbella Itsbella

03-03-2017

Soil is a vital part of the natural environment. It is just as important as plants, animals, rocks, landforms, lochs and rivers.

Answer Link

Otras preguntas

With the two endpoints of a diamter how many right triangles can be formed

It is illegal for a minor to even attempt to purchase alcohol. a. True b. False

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

a chef uses 4 3/4 cups of broth for 10 servings of soup. How much broth is used in one serving of soup?

Biggest reason why the united states did not want to enter world war 1

Questions 1–10: Identify each redundant expression. Some sentences contain no redundancies. 1. Weather conditions forced the regional managers to postpone thei

The perimeter of an equilaterak triangle is 858 millimeters. find the length of each side

Tyra makes $21.40 per hour at her job for the first 40 hours and $32.10 for anything over 40 hours. if tyra typically works 45 hours per week, how much does she

How do you determine the type of ion charge any element will form based on its number of valence electrons?

can someone help me please