gmcorchado
gmcorchado gmcorchado
  • 05-02-2022
  • Mathematics
contestada

Help please!! Urgent!!

Help please Urgent class=

Respuesta :

thishigopal
thishigopal thishigopal
  • 05-02-2022

Step-by-step explanation:

similar triangles will have congruent angles.

so statement 1,2 are true to AAA theorem

angle A is common angle, statement 3 is true

statement 4 : congruent

last one ans;: corresponding angle procedure

Answer Link

Otras preguntas

Please help I WILL GIVE BRAINLIEST!!! Aryans -Describe Their Geography -Describe Their Culture (social classes, daily life, religion) -Describe Their Economy/Jo
Help Pls will give brainlyest Thanks!
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
At Pizza Company, Lee made 50 pizzas one day. There were 110 pizzas sold that day. What fraction of the pizzas did Lee make? Simplify your answer, without using
How would the number 48.15 be written in words?
To rename a worksheet, you change the text on the ? HELP ASAP A. Sheet Columns B. Sheet Header C. Sheet tab
what does hamlet see as degrading to the nobility of humans?
What type of angle is angle M? A. Acute B. Right C. Straight D. Obtuse
Two angles form a linear pair. The measure of one angle is three times the measure of the other angle. Find the measure of each angle.
Please answer this sanskrit question correctly and i'll mark you as brainlilest! Ty :)