goldingjeniah605 goldingjeniah605
  • 04-04-2021
  • English
contestada

how do bolivia people use the land farming

Respuesta :

brookebrooke789
brookebrooke789 brookebrooke789
  • 04-04-2021
The region produces the vast majority of Bolivia's agricultural exports, grown principally on large commercial farms (50-75 hectares) using modern methods. In the northern departments, rice, cattle and timber are the main agricultural products, while further south cattle, soybeans, coffee, rice and maize dominate.
Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
What did lamarck contribute to the theory of evolution? 101. explain the information that influenced darwin's view of natural selection/ evolution. 102. define
Solve the system algebraically. check your work. 2x + 5y = 10 2x + 3y = 6
stuck i need help please
Plane ABC and plane BCE ____ be the same plane. Question 4 options: cannot must may
which ones are rational 1. 2.4 2. 74 3. 17.3333333… 4. π 5. 6. –18 7. 8. 87.125 9. –30 10. –8.3 11. 58.25 12. 121 13. 4.5 14.3 7/10
Which of the following has faces that are pentagons?A. HexahedronB. OctahedronC. IcosahedronD. Dodecahedron
this is a class called foundation seminar music and math
Multivitamin/mineral supplements should never be given to toddlers. a. True b. False
PLEASE HELP!!!!!!!! Which of the following is a continuous random variable? A) the number of employees in an office B) the salaries of employees in an off