Seudónimo Seudónimo
  • 12-02-2021
  • Mathematics
contestada

Will mark brainliest if u help! Please answer both questions! They are very easy

Will mark brainliest if u help Please answer both questions They are very easy class=
Will mark brainliest if u help Please answer both questions They are very easy class=

Respuesta :

eeuoniaah
eeuoniaah eeuoniaah
  • 12-02-2021
d and 3, sorry if wrong hahaha
Answer Link

Otras preguntas

Please help me guys I will give brainliest to right answers "The Fall of the House of Usher" Part A: what does the term "simulate" most likely mean, as used in
The RNA meets with the organelle ribosome that will read it to build a polypeptide chain of amino acids, following the process of translation . Specifically thi
Choose the best answer. Who is most likely to live in un palacio? king ant slave bear
Un enunț in care vei constata dacă sintagma primăvara popoarelor poate fi atribuita și revoluției romane din 1848-1849
Which is NOT a traditional item of clothing from Mexico and/or Central America? Question 3 options: Sombrero Panama Hat China Poblano Huipil
what should a reflection do in a narrative essay? select three options.
which one is greater 4/6 12/12​
how does choreographer used time?
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
50 POINTS!!!From 1970 to 1990, the average cost of a new car C (in dollars) car aproximated by the model C= 30.5p^2 + 4192 where t is the number of vears since