kingchris326 kingchris326
  • 05-06-2020
  • Mathematics
contestada

A box has a volume of 22 1/2 in³. Find the length of the box!

Respuesta :

proz
proz proz
  • 06-06-2020

Answer:

Length = 2.823 in (to 3 decimal places)  

Step-by-step explanation:

assuming that the box is a cubic box:

volume of box = [tex]22\frac{1}{2}[/tex] in³ = 22.5 in³

volume = Length × Length × Length = (Length)³

∴ (Length)³ = 22.5

∴ Length = ∛(22.5)

using the calculator punch ∛(22.5), and the answer is:

∴ Length = 2.823 in (to 3 decimal places)

Answer Link

Otras preguntas

who ruled over the islamic empire after the death of muhammad ?
how is human dna & chimp dna different
Which of the timelines above correctly plots events in New Zealand’s history
Which seasons do u like most?Why?​
what are textual aids?graphic organizers?​
The religion that was born in the area around Jerusalem is called 1. Christianity 2. Judaism 3. Hinduism 4. Buddhism
A stone is dropped into a well and is heard to hit the water 2.27 s after being dropped. Determine the depth of the well.​
10 pts If n stands for the unknown number, which expression represents the phrase below? the sum of a number and three, divided by seven 07 / (n + 3) On + 7/3
Give the digits in the tens place and the hundredths place. 82.46
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'