Iwritewithpencils Iwritewithpencils

14-05-2020
Biology

contestada

How do I use a codon wheel to solve this sequence of DNA?

AGTACCCGTTAATTAGTTGCCG

Respuesta :

andyk38105 andyk38105

14-05-2020

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

Answer Link

Otras preguntas

Brody added a fraction to 5/6 to get 31/30. Use the equation a/b + c/d = (ad +bc)/ bd to find the fraction he added

how is aluminium foil able to reduce heat loss through the walls of a house

why did texans drive their cattle to towns in the midwest

In a parallelogram, one angle is 9 times the size of another. Find the measures of the angles.

What would be most useful to help make a simple compass a nonmetal bar,a round metal can,a small iron nail,or a Quartz needle

what produces the motion of air convection

A bottle of fruit juice is 800 milliliters. How many liters of fruit juice are in 120 bottles?

Are many valuable minerals found in or near areas of volcanic activity and mountain building?

A bottle of fruit juice is 800 milliliters. How many liters of fruit juice are in 120 bottles?

what act did the united states government pass in order to be able to move Native American of their lands into the Indian's Territory? A) Native American Act B)